Stool sample was directly streaked onto modified Charcoal Cefoperazone Deoxycholate Agar (CCDA) (Oxoid, Hampshire, England) containing CAT antibiotic supplement (Cefoperazone 8 mg/litter, Amphotericin B 20 mg/litter, Teicoplanin 8 mg/litter) (Oxoid, Hampshire, England) These plates were incubated under microaerophilic conditions (Oxoid Campygen sachets Oxoid, Hampshire) for 48 to 72 h at 42 °C [ 25]. The isolated colonies were primarily identified on the basis of Gram staining, catalase, hippurate hydrolysis and oxidase activity. For molecular identification, DNA extraction was performed using phenol/chloroform method which was a modified version of Cheng and Jiang [ 26]. A negative extraction control with PBS and positive control was included in the extraction as well as in each PCR runs in each batch. Species specific primer for the detection of C. jejuni are HipO-F, (GACTTCGTGCAGATATGGATGCTT) and HipO-R, (GCTATAACTATCCGAAGAAGCCATCA) were used [ 27]. Thermo cycler conditions were 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 52 °C for 45 s and 72 °C for 60s, and finally 72 °C for 10 min. Cj255 was used as positive control [ 27]. Detection of group a Rotavirus in Faecal samples Jin, Y.; Cheng, W.-X.; Yang, X.-M.; Jin, M.; Zhang, Q.; Xu, Z.-Q.; Yu, J.-M.; Zhu, L.; Yang, S.-H.; Liu, N.; et al. Viral agents associated with acute gastroenteritis in children hospitalized with diarrhea in Lanzhou, China. J. Clin. Virol. 2009, 44, 238–241. [ Google Scholar] [ CrossRef] [ PubMed] Qamar, F.N.; Zaman, U.; Quadri, F.; Khan, A.; Shaikh, B.T.; Azam, I.; Nasrin, D.; Kotloff, K.; Levine, M.; Brown, N.; et al. Predictors of diarrheal mortality and patterns of caregiver health seeking behavior in in Karachi, Pakistan. J. Glob. Health 2016, 6, 020406. [ Google Scholar] [ CrossRef] [ PubMed] If the frequency rises to twice the number of normal stools, it is considered diarrhea for young infants. Although both treatable and preventable, diarrhea is the cause of death for 2195 children daily around the world, which is more than malaria, AIDS, and measles combined. Gentsch JR, Glass RI, Woods P, Gouvea V, Gorziglia M, Flores J, et al. Identification of group a rotavirus gene 4 types by polymerase chain reaction. J Clin Microbiol. 1992;30(6):1365–73.

If you have a weakened immune system because of, for example, chemotherapy treatment, long-term steroid treatment, or HIV infection. The adult dose of this is two capsules at first. This is followed by one capsule after each time you pass some diarrhoea up to a maximum of eight capsules in 24 hours. It works by slowing down your gut's activity. Jansen A, Stark K, Kunkel J, Schreier E, Ignatius R, Liesenfeld O, et al. Aetiology of community-acquired, acute gastroenteritis in hospitalised adults: a prospective cohort study. BMC Infect Dis 2008; 8: 143. Rao MR, Naficy AB, Savarino SJ, Abu-Elyazeed R, Wierzba TF, Peruski LF, et al. Pathogenicity and convalescent excretion of Campylobacter in rural Egyptian children. Am J Epidemiol. 2001;154(2):166–73 Available from: http://www.ncbi.nlm.nih.gov/pubmed/11447051. [cited 2018 Sep 23]. Aminu, M.; Ahmad, A.; Umoh, J.; De Beer, M.; Esona, M.; Steele, A. Adenovirus infection in children with diarrhea disease in Northwestern Nigeria. Ann. Afr. Med. 2007, 6, 168–173. [ Google Scholar] [ CrossRef][ Green Version]Rawalpindi and Islamabad are the third most populous metropolitan cities of Pakistan. The high population size (4.5 million) strengthen the epidemiological monitoring of infectious diseases including gastroenteritis. Benazir Bhutto Shaheed Hospital Rawalpindi (BBH) is a public sector tertiary care hospital with heavy influx (2500 daily) of patients visiting hospital in OPDs (Out patient departments). The hospital is located on the main road in the crowded population of the city. Pakistan Institute of Medical Sciences (PIMS) is research oriented health sciences institute. This is a leading institute for training of doctors and other health staff from all over Pakistan. It is the major referral tertiary care hospital of Capital city Islamabad. There are 200 hospitalizations with 9000 cases in OPD/day in this hospital. The main target of the hospital is to provide health facilities not only to the residents of Rawalpindi/Islamabad but to the people of Northern Areas, Azad Jammu and Kashmir, NWFP ( North-West Frontier Province) and Northern areas of Punjab. Study design Athiyyah AF, Utsumi T, Wahyuni RM, Dinana Z, Yamani LN, Soetjipto, et al. Molecular Epidemiology and Clinical Features of Rotavirus Infection Among Pediatric Patients in East Java, Indonesia During 2015–2018: Dynamic Changes in Rotavirus Genotypes From Equine-Like G3 to Typical Human G1/G3. Front Microbiol. 2019;10:940 Available from: https://www.frontiersin.org/article/10.3389/fmicb.2019.00940/full. [cited 2019 May 12].

One way to curb this increase in diarrheal diseases especially in children is to establish educational programs throughout schools in Pakistan to enlighten the public about healthy safety measures, and the first step is to adhere correctly to a theory or model of health education. Rarely, other parts of your body can 'react' to an infection that occurs in your gut. This can cause symptoms such as joint inflammation (arthritis), skin inflammation and eye inflammation (either conjunctivitis or uveitis). Reactive complications are uncommon if you have a virus causing traveller's diarrhoea. Spread of infection Ascher DP, Edusada-Corpus R. Clinical and laboratory predictors of bacterial diarrhoea in a tropical environment. Mil Med 1991; 156: 74-6. Shimizu, H.; Phan, T.G.; Nishimura, S.; Okitsu, S.; Maneekarn, N.; Ushijima, H. An outbreak of adenovirus serotype 41 infection in infants and children with acute gastroenteritis in Maizuru City, Japan. Infect. Genet. Evol. 2007, 7, 279–284. [ Google Scholar] [ CrossRef] Bahl R, Ray P, Subodh S, Shambharkar P, Saxena M, Parashar U, et al. Incidence of Severe Rotavirus Diarrhea in New Delhi, India, and G and P Types of the Infecting Rotavirus Strains. J Infect Dis. 2005;192(s1):S114–9 Available from: https://academic.oup.com/jid/article-lookup/doi/10.1086/431497. [cited 2018 Sep 23].Rathaur, et al. Clinical study of acute childhood diarrhoea caused by bacterial enteropathogens. J Clin Diagn Res. 2014;8(5):PC01–5. In the cities of Islamabad and Rawalpindi, hundreds of children are being admitted daily with bouts of acute viral diarrhea. Irritable bowel syndrome is sometimes triggered by a bout of traveller's diarrhoea. Lactose intolerance Bagheri, R.; Rabbani, B.; Mahdieh, N.; Khanahmad, H.; Abachi, M.; Asgari, S. PCR-ELISA: A diagnostic assay for identifying Iranian HIV seropositives. Mol. Genet. Mikrobiol. Virusol. 2013, 3, 36–39. [ Google Scholar] [ CrossRef] Kosek M, Bern C, Guerrant RL. The global burden of diarrhoeal disease, as estimated from studies published between 1992 & 2000. Bull World Health Organ 2003; 81: 197-204.

If you are elderly or have an underlying health problem such as diabetes, inflammatory bowel disease, or kidney disease. Lactose intolerance leads to bloating, tummy (abdominal) pain, wind and watery stools after drinking milk. The condition gets better when the infection is over and the intestinal lining heals. It is more common in children. Haemolytic uraemic syndrome Guerrant RL, Van Gilder T, Steiner TS, Thielman NM, Slutsker L, Tauxe RV, et al. Practice guidelines for the management of infectious diarrhea. Clin Infect Dis 2001; 32: 331-51.World Health Organization. Polio Laboratory Manual; World Health Organization: Geneva, Switzerland, 2004. The identification of clinical predictors of positive stool culture will help the physician in determining the necessity for stool requests. Our results indicated, severity of diarrhoea (measured by total number of stools per day) is an important physical indicator of stool culture positivity. This finding is consistent with that of previous studies. 10-12 However; contrasting evidence exists regarding duration of diarrhoea. Koplan et al8 and our results associate it with positive stool culture while Chan SS et al 10 report longer duration of diarrhoea in patients with negative stool culture. Many researchers have found higher body temperature in patients with positive stool cultures, 8,10,13 however; our findings did not support this. Previous studies have also shown that blood in stool, whether it is occult or gross, increases the likelihood of obtaining positive stool culture. 8 That was not the case in our study. With regard to the predictive value of faecal leukocytes, besides Koplan et al 8 most of the studies found it to be the best screening tool and strongly associated with culture positivity both in adult 14,15 and paediatric 9,10 patients. Based on the above discussion, it seems that there is no single agreed upon physical or laboratory parameter of stool culture positivity and predictors tend to vary across regions.